90719 - mozilla crashes after using "Back" button

Status: RESOLVED DUPLICATE of bug 88343

(SeaMonkey :: General, defect)

Description

[darked]

From Bugzilla Helper:
User-Agent: Mozilla/5.0 (X11; U; Linux i686; en-US; rv:0.9.2) Gecko/20010628
BuildID:    2001062823

mozilla crashes after using "Back" button:
./run-mozilla.sh: line 72:  6274 Segmentation fault      $prog ${1+"$@"}    

Reproducible: Always 
Steps to Reproduce:
1.go to http://www.ncbi.nlm.nih.gov/blast/
2. select one of the blast searches (like the first one):
http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Web&LAYOUT=TwoWindows&AUTO_FORMAT=Semiauto&ALIGNMENTS=50&ALIGNMENT_VIEW=Pairwise&CLIENT=web&DATABASE=nr&DESCRIPTIONS=100&ENTREZ_QUERY=(none)&EXPECT=10&FILTER=L&FORMAT_OBJECT=Alignment&FORMAT_TYPE=HTML&HITLIST_SIZE=100&NCBI_GI=on&PAGE=Nucleotides&PROGRAM=blastn&SERVICE=plain&SET_DEFAULTS.x=34&SET_DEFAULTS.y=8&SHOW_OVERVIEW=on&END_OF_HTTPGET=Yes
3. put fasta seq in the text window:
>XM_012358.1
AAGGAAATAATAAAAGAAATACATACATTAAAATAAAATGGAAAATGTCTTGCCATTTTACATATTTTAA
GAACAGTATATAATGAATCTTTAGGTATCCATCATGAAAATTTGGTAATAACTCACCTATGTGCAATCTC
CCCTATCTGGAAATCTTCTTGGCCATATGTATTAAGAGAATCCTAATGCATTTTATTGCTTCAAATATGG
TCCAAATGCAGGAATCACTTTGCCTTTTTTCTCTCTCTCTTTCTCCCTTTCTATCCCACCCACCCCATCC

4. press BLAST! button (it goes to troublesome URL www.ncbi.nih.gov/blast/Blast.cgi)
5. press Format! (new Results window pops out)
6. Press Back button from mozilla menus -> CRASH


Actual Results:  ./run-mozilla.sh: line 72: 6274 Segmentation fault $prog ${1+"$@"} 

Expected Results:  Regular Blast form with fasta sequence and all settings

I've got it selecting various Blast forms (Step 2).

Comment 1

[Chris Hiner]

WFM with a linux cvs build from this morning.

Comment 2

[Harald Glatt]

wfm 2001071304 on win2k sp2;

reporter please try a current build and report here again

Comment 3

[Asa Dotzler [:asa]]

probably bug 88343

Comment 4

[Con Kolivas]

WFM Linux build 2001070116

Comment 5

[Diego Biurrun]

Try a nightly build, this has been fixed.

*** This bug has been marked as a duplicate of 88343 ***